ID: 938436314

View in Genome Browser
Species Human (GRCh38)
Location 2:131285511-131285533
Sequence CTTTTCCAGTGTCAGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938436304_938436314 10 Left 938436304 2:131285478-131285500 CCAGCCTTGTGCTCCCCATTCTC No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436303_938436314 14 Left 938436303 2:131285474-131285496 CCTGCCAGCCTTGTGCTCCCCAT No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436305_938436314 6 Left 938436305 2:131285482-131285504 CCTTGTGCTCCCCATTCTCCCAG No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436302_938436314 15 Left 938436302 2:131285473-131285495 CCCTGCCAGCCTTGTGCTCCCCA No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436309_938436314 -5 Left 938436309 2:131285493-131285515 CCATTCTCCCAGGTCCCACTTTT No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436300_938436314 26 Left 938436300 2:131285462-131285484 CCTGGAGCATCCCCTGCCAGCCT No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436307_938436314 -3 Left 938436307 2:131285491-131285513 CCCCATTCTCCCAGGTCCCACTT No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436301_938436314 16 Left 938436301 2:131285472-131285494 CCCCTGCCAGCCTTGTGCTCCCC No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436308_938436314 -4 Left 938436308 2:131285492-131285514 CCCATTCTCCCAGGTCCCACTTT No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938436314 Original CRISPR CTTTTCCAGTGTCAGCCAGC AGG Intronic
No off target data available for this crispr