ID: 938436554

View in Genome Browser
Species Human (GRCh38)
Location 2:131286674-131286696
Sequence TCTGAGATGCAGGTGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938436554_938436563 14 Left 938436554 2:131286674-131286696 CCTGGCACCACCTGCATCTCAGA No data
Right 938436563 2:131286711-131286733 CTCCTTAACCAGAGGACAGCAGG No data
938436554_938436565 19 Left 938436554 2:131286674-131286696 CCTGGCACCACCTGCATCTCAGA No data
Right 938436565 2:131286716-131286738 TAACCAGAGGACAGCAGGCCTGG No data
938436554_938436562 6 Left 938436554 2:131286674-131286696 CCTGGCACCACCTGCATCTCAGA No data
Right 938436562 2:131286703-131286725 GTGGCACACTCCTTAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938436554 Original CRISPR TCTGAGATGCAGGTGGTGCC AGG (reversed) Intronic
No off target data available for this crispr