ID: 938444610

View in Genome Browser
Species Human (GRCh38)
Location 2:131367246-131367268
Sequence CCCTGGGGCTCCCAGGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938444610_938444625 25 Left 938444610 2:131367246-131367268 CCCGAAGCCTGGGAGCCCCAGGG No data
Right 938444625 2:131367294-131367316 TCCCCAGAAGGGGTCAACATGGG No data
938444610_938444624 24 Left 938444610 2:131367246-131367268 CCCGAAGCCTGGGAGCCCCAGGG No data
Right 938444624 2:131367293-131367315 GTCCCCAGAAGGGGTCAACATGG No data
938444610_938444620 15 Left 938444610 2:131367246-131367268 CCCGAAGCCTGGGAGCCCCAGGG No data
Right 938444620 2:131367284-131367306 GAAACCCCTGTCCCCAGAAGGGG No data
938444610_938444616 -7 Left 938444610 2:131367246-131367268 CCCGAAGCCTGGGAGCCCCAGGG No data
Right 938444616 2:131367262-131367284 CCCAGGGCAGTAATAACTATAGG No data
938444610_938444619 14 Left 938444610 2:131367246-131367268 CCCGAAGCCTGGGAGCCCCAGGG No data
Right 938444619 2:131367283-131367305 GGAAACCCCTGTCCCCAGAAGGG No data
938444610_938444618 13 Left 938444610 2:131367246-131367268 CCCGAAGCCTGGGAGCCCCAGGG No data
Right 938444618 2:131367282-131367304 AGGAAACCCCTGTCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938444610 Original CRISPR CCCTGGGGCTCCCAGGCTTC GGG (reversed) Intergenic
No off target data available for this crispr