ID: 938451424

View in Genome Browser
Species Human (GRCh38)
Location 2:131424971-131424993
Sequence GACGCGCGCCCAGGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938451424_938451437 6 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451437 2:131425000-131425022 GAGCTCCGGGAACCGCCGCGGGG No data
938451424_938451435 4 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451435 2:131424998-131425020 ACGAGCTCCGGGAACCGCCGCGG No data
938451424_938451446 23 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451446 2:131425017-131425039 GCGGGGGCGGCGGCCAGGGCCGG No data
938451424_938451432 -8 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451432 2:131424986-131425008 CGCGCGTCCGGGACGAGCTCCGG No data
938451424_938451443 18 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451443 2:131425012-131425034 CCGCCGCGGGGGCGGCGGCCAGG No data
938451424_938451444 19 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451444 2:131425013-131425035 CGCCGCGGGGGCGGCGGCCAGGG No data
938451424_938451439 10 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451439 2:131425004-131425026 TCCGGGAACCGCCGCGGGGGCGG No data
938451424_938451436 5 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451436 2:131424999-131425021 CGAGCTCCGGGAACCGCCGCGGG No data
938451424_938451441 13 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451441 2:131425007-131425029 GGGAACCGCCGCGGGGGCGGCGG No data
938451424_938451448 25 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451448 2:131425019-131425041 GGGGGCGGCGGCCAGGGCCGGGG No data
938451424_938451447 24 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451447 2:131425018-131425040 CGGGGGCGGCGGCCAGGGCCGGG No data
938451424_938451438 7 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451438 2:131425001-131425023 AGCTCCGGGAACCGCCGCGGGGG No data
938451424_938451433 -7 Left 938451424 2:131424971-131424993 CCCCCGCCGCCTGGGCGCGCGTC No data
Right 938451433 2:131424987-131425009 GCGCGTCCGGGACGAGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938451424 Original CRISPR GACGCGCGCCCAGGCGGCGG GGG (reversed) Intergenic
No off target data available for this crispr