ID: 938455668

View in Genome Browser
Species Human (GRCh38)
Location 2:131460943-131460965
Sequence CGGGGCCGGGGCGGGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938455651_938455668 2 Left 938455651 2:131460918-131460940 CCCCCAGGCGGGCCGGGGCTGAG No data
Right 938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG No data
938455653_938455668 0 Left 938455653 2:131460920-131460942 CCCAGGCGGGCCGGGGCTGAGCC No data
Right 938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG No data
938455650_938455668 3 Left 938455650 2:131460917-131460939 CCCCCCAGGCGGGCCGGGGCTGA No data
Right 938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG No data
938455654_938455668 -1 Left 938455654 2:131460921-131460943 CCAGGCGGGCCGGGGCTGAGCCC No data
Right 938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG No data
938455659_938455668 -10 Left 938455659 2:131460930-131460952 CCGGGGCTGAGCCCGGGGCCGGG No data
Right 938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG No data
938455652_938455668 1 Left 938455652 2:131460919-131460941 CCCCAGGCGGGCCGGGGCTGAGC No data
Right 938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938455668 Original CRISPR CGGGGCCGGGGCGGGGGCTC CGG Intergenic
No off target data available for this crispr