ID: 938457496

View in Genome Browser
Species Human (GRCh38)
Location 2:131476096-131476118
Sequence CCCGTGCGGCGCGCACAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938457492_938457496 -10 Left 938457492 2:131476083-131476105 CCGGCGGGCCAATCCCGTGCGGC 0: 1
1: 0
2: 1
3: 5
4: 35
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457487_938457496 7 Left 938457487 2:131476066-131476088 CCAATGGCGGCCTGGCACCGGCG 0: 1
1: 1
2: 1
3: 5
4: 61
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457490_938457496 -3 Left 938457490 2:131476076-131476098 CCTGGCACCGGCGGGCCAATCCC 0: 1
1: 0
2: 2
3: 5
4: 69
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457477_938457496 29 Left 938457477 2:131476044-131476066 CCCGCCTCCCAGGAACTCCGAGC 0: 2
1: 0
2: 1
3: 22
4: 286
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457478_938457496 28 Left 938457478 2:131476045-131476067 CCGCCTCCCAGGAACTCCGAGCC 0: 1
1: 0
2: 1
3: 28
4: 284
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457479_938457496 25 Left 938457479 2:131476048-131476070 CCTCCCAGGAACTCCGAGCCAAT 0: 2
1: 0
2: 1
3: 7
4: 120
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457481_938457496 22 Left 938457481 2:131476051-131476073 CCCAGGAACTCCGAGCCAATGGC 0: 2
1: 0
2: 0
3: 9
4: 82
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457485_938457496 12 Left 938457485 2:131476061-131476083 CCGAGCCAATGGCGGCCTGGCAC 0: 2
1: 0
2: 1
3: 10
4: 89
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96
938457482_938457496 21 Left 938457482 2:131476052-131476074 CCAGGAACTCCGAGCCAATGGCG 0: 2
1: 0
2: 0
3: 2
4: 40
Right 938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938457496 Original CRISPR CCCGTGCGGCGCGCACAGGC AGG Exonic
900199858 1:1399594-1399616 CCCGCTCGGGGCGCACAGGCAGG - Exonic
900532507 1:3161640-3161662 CCCGCCCGGCGCGGAGAGGCCGG + Intronic
900955948 1:5886627-5886649 GCCCTGAGGTGCGCACAGGCAGG + Intronic
902455760 1:16532992-16533014 CCCGTGCAGAGGGCACCGGCTGG + Intergenic
902496412 1:16874920-16874942 CCCGTGCAGAGGGCACCGGCTGG - Intronic
902911017 1:19597234-19597256 CCCGGGCGGCTCGCCCTGGCCGG - Intronic
915129631 1:153687678-153687700 CCTGTGCGGGGCTCCCAGGCTGG + Exonic
916179187 1:162069673-162069695 CCTGTGGGGCGGGCCCAGGCCGG - Intergenic
920401583 1:205679892-205679914 TCACTGCGGCGCGCACAGTCCGG - Intronic
920854638 1:209652640-209652662 CCCTTGCAGCCCCCACAGGCAGG - Intergenic
1063458947 10:6203437-6203459 CCCGTGCGGGTCGCGCCGGCGGG + Intronic
1069709319 10:70478793-70478815 GCAGCGCGGCGCGCACGGGCCGG + Intergenic
1070819720 10:79347762-79347784 CCCGTGTCCCGCGCCCAGGCCGG - Intronic
1074357467 10:112799009-112799031 TCCATGAGGCGCGCACAGGCTGG + Intronic
1076771702 10:132669677-132669699 CCCATGGGGCACGCACAGGCAGG - Intronic
1076936128 10:133568281-133568303 CCGGGGCGGCGGGCTCAGGCTGG - Intronic
1077281681 11:1748920-1748942 CCCGTGCGGCGCTCGCCGGGGGG + Intronic
1077317465 11:1925805-1925827 CCCTTGAGGTGCACACAGGCTGG + Intronic
1077890311 11:6413508-6413530 CAGGTGCGGTGCGCCCAGGCTGG + Intronic
1091386981 12:101995-102017 CCTGTGGGGCTGGCACAGGCGGG + Intronic
1098943026 12:76559396-76559418 CCCGTGCGGAGCTCCCAGGGAGG + Exonic
1101372003 12:104138447-104138469 CCCGAACGGCGCGCCCGGGCAGG - Intergenic
1102676828 12:114665089-114665111 CCCGCGCGGCGGGCCCAGGAAGG - Intergenic
1103325293 12:120116486-120116508 CCCGTGCGGGGCGGGCGGGCGGG - Intronic
1105202766 13:18194243-18194265 CCCGTGCGCCCCGGCCAGGCGGG + Intergenic
1106180041 13:27362468-27362490 CCAGAGCGGCGCTCACAGGTCGG + Intergenic
1116871629 14:50073915-50073937 CCCGGGCGGCGCTCGCCGGCGGG - Intergenic
1124657819 15:31523265-31523287 CCTGTGGGGCCGGCACAGGCAGG + Intronic
1125626750 15:41115694-41115716 CCCGTGGGGCGCCCACACGTGGG - Intronic
1129220217 15:74128132-74128154 GCCGTCCGGCGCGCAGAAGCGGG - Exonic
1132770672 16:1561031-1561053 CCCCTGTGGGGCTCACAGGCCGG + Intronic
1132779451 16:1614592-1614614 CCGGTGAGGCGGGCGCAGGCCGG - Intronic
1134106859 16:11491718-11491740 CAGGTGCGGCGCACCCAGGCAGG - Exonic
1137869662 16:51937837-51937859 CCCGTGCTGTGAGCACAGACAGG + Intergenic
1141727559 16:85799769-85799791 CCGGTGCGGCGCCGCCAGGCCGG + Exonic
1141970036 16:87475131-87475153 CCCATGCTGCCAGCACAGGCAGG + Intronic
1146398627 17:32487219-32487241 CCCGTGCGGGGTGTCCAGGCGGG + Intronic
1146439041 17:32877279-32877301 CCTGGGCGGCGCGCACGCGCGGG + Intergenic
1146445401 17:32928420-32928442 CCCGTGCGGCGCGTCCCGGGCGG + Intronic
1149570622 17:57669826-57669848 CCCGAGCCACACGCACAGGCTGG + Intronic
1152564206 17:81092969-81092991 CCCGAGCGGTGGGCACAGGCTGG - Intronic
1154133114 18:11752610-11752632 CCCCAGCGGAGCGCACAGCCAGG + Intronic
1154151362 18:11908793-11908815 CCGTTGCGGGGCGCACAGGCGGG + Exonic
1156369098 18:36456639-36456661 CCCGTGGGGGACACACAGGCTGG - Intronic
1159814680 18:73058625-73058647 CACGTGCTGCACGAACAGGCAGG - Intergenic
1160863916 19:1249046-1249068 TCCGGGCGGCGCTCCCAGGCGGG + Intronic
1161396677 19:4048240-4048262 CCCGTGCCCCGTCCACAGGCAGG - Exonic
1202706652 1_KI270713v1_random:29349-29371 CCCGTGCAGAGGGCACCGGCTGG + Intergenic
925971576 2:9110179-9110201 CCCCTGCAGAGAGCACAGGCTGG + Intergenic
926171500 2:10555730-10555752 CCCGTGGGGCAGGCAGAGGCTGG + Intergenic
934500548 2:94857485-94857507 CCCTGGCGGCGCGCGCCGGCAGG + Intergenic
935593755 2:104863956-104863978 CCCGTGCGGCGCGCAGGGCCTGG - Intergenic
935671433 2:105560124-105560146 CCCGTGCTGCCAGCACAGCCAGG + Intergenic
938299222 2:130198442-130198464 CCTGTGCGGCGCGCGTGGGCAGG - Exonic
938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG + Exonic
942084088 2:172428071-172428093 CCCGTGGGTCGCGCCCGGGCCGG + Intronic
948587422 2:239028089-239028111 CCCACGCTGCGCGCACAGCCAGG + Intergenic
1174054067 20:47785870-47785892 GCCGTGCGCCGGGGACAGGCAGG - Exonic
1179606397 21:42518341-42518363 CCCCTGCCGCTCCCACAGGCTGG - Exonic
1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG + Intronic
1180908475 22:19431910-19431932 CCCGGGCCGCCCGCAGAGGCAGG + Exonic
1181541303 22:23574558-23574580 CCCGTGTGGCCCTCCCAGGCTGG + Intronic
1184717138 22:46288682-46288704 CCCCTGCTGCACTCACAGGCGGG - Intronic
1185272348 22:49935236-49935258 CCCGGGCGCCGGGCAGAGGCTGG - Intergenic
953748587 3:45593635-45593657 GCCGGGCGGCGGGCACAGCCTGG + Intronic
956892229 3:73624280-73624302 CTTGTGCAGCGCGCCCAGGCGGG + Exonic
960955403 3:123027510-123027532 CCCGGGCGGCGCGGAGCGGCGGG + Intronic
968688653 4:1978334-1978356 CCAGCGCGGCGTGGACAGGCAGG - Intronic
978576713 4:110196773-110196795 CCTGGGCCGCGCGCACCGGCGGG - Intronic
985776966 5:1849442-1849464 CCCGTGCTGTGCGCACATGAGGG - Intergenic
998142797 5:139709582-139709604 CCCCAGCAGCGCGCACAGGGAGG - Intergenic
1002445527 5:179287876-179287898 CCCATGGGGAGAGCACAGGCTGG + Intronic
1002578708 5:180194147-180194169 CCCGTCCGGCTCACACAGGGAGG - Intronic
1003926798 6:10883996-10884018 CCCGTGCTGAGCGCACGGACGGG + Intronic
1004709389 6:18155491-18155513 CGCGCGCCGCGCGCACAGGACGG - Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1016658056 6:146543689-146543711 CCCGGGCCGCGAGCACTGGCGGG + Exonic
1017073768 6:150599972-150599994 CCCGGGCGGCGCTCGCAGGTCGG - Exonic
1017163757 6:151390241-151390263 CTGTTGCGGCGCGCTCAGGCGGG - Intronic
1017525699 6:155239856-155239878 GCCCTGCAGAGCGCACAGGCAGG - Intronic
1017839543 6:158210127-158210149 CGCAAGCGCCGCGCACAGGCCGG + Intergenic
1022025110 7:26441237-26441259 CCTGTGCGGCGCTCCCAGGATGG - Intergenic
1026883318 7:73921015-73921037 CCCGAGGGGCACGCCCAGGCGGG + Intergenic
1034435249 7:151060112-151060134 CCCGTCCGGGGCGCCCAGACTGG + Intronic
1035928470 8:3755531-3755553 CAGCTGCGGCGCTCACAGGCAGG - Intronic
1036242453 8:7091898-7091920 CCCGCGCAGCGCGGACACGCCGG - Intergenic
1036899363 8:12659532-12659554 CCCGCGCAGCGCGGACACGCCGG + Intergenic
1039875036 8:41578106-41578128 CCCGTCGGGCGCGCGCGGGCCGG - Intronic
1042048800 8:64685155-64685177 CCCGGGCGGCGCTCGCCGGCGGG - Intronic
1044821991 8:96161020-96161042 CCCGCGCCGCGCGCACCGCCCGG - Intergenic
1045664046 8:104466949-104466971 CCCGGGCTGCGCGCAGGGGCTGG + Exonic
1049815376 8:144596707-144596729 CCCGGGTGGCGCGCACTGCCGGG + Intronic
1051947033 9:22581446-22581468 CCCCTGGGGTTCGCACAGGCTGG + Intergenic
1053906977 9:42852285-42852307 CCCTGGCGGCGCGCGCCGGCAGG - Intergenic
1054357043 9:64071510-64071532 CCCTGGCGGCGCGCGCTGGCAGG - Intergenic
1056753536 9:89368336-89368358 CCCGGGCAGCGGGTACAGGCAGG - Intronic
1061971979 9:134049948-134049970 CCCATGTGGAGCCCACAGGCGGG + Intronic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1187698227 X:21941291-21941313 CCCGCGCGGCGAGCCCGGGCTGG + Intronic
1195716815 X:107826204-107826226 CCCCTGCGGGGCGCGCGGGCTGG + Exonic
1199772545 X:150983880-150983902 CCCGTGCGGCGGCCCCCGGCGGG - Intronic
1199972134 X:152868970-152868992 CCCATGCGGGTCGCACTGGCTGG + Exonic
1201489507 Y:14525006-14525028 CCCGTGCCGCGCGCAAATCCGGG + Intronic