ID: 938462573

View in Genome Browser
Species Human (GRCh38)
Location 2:131507447-131507469
Sequence CATGATGCCCAGATGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938462565_938462573 3 Left 938462565 2:131507421-131507443 CCGTTGCCCCTGTTCACAGAGGG No data
Right 938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG No data
938462570_938462573 -5 Left 938462570 2:131507429-131507451 CCTGTTCACAGAGGGGACCATGA No data
Right 938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG No data
938462563_938462573 27 Left 938462563 2:131507397-131507419 CCTCGCAGGGTGGAATGGTAAGA No data
Right 938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG No data
938462568_938462573 -3 Left 938462568 2:131507427-131507449 CCCCTGTTCACAGAGGGGACCAT No data
Right 938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG No data
938462569_938462573 -4 Left 938462569 2:131507428-131507450 CCCTGTTCACAGAGGGGACCATG No data
Right 938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938462573 Original CRISPR CATGATGCCCAGATGGCTCT TGG Intergenic
No off target data available for this crispr