ID: 938463300

View in Genome Browser
Species Human (GRCh38)
Location 2:131511495-131511517
Sequence CTGCGCTGGCCCGCGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938463297_938463300 -3 Left 938463297 2:131511475-131511497 CCTGGCTGCGGAGGCGGGTGCTG No data
Right 938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG No data
938463293_938463300 3 Left 938463293 2:131511469-131511491 CCCTGGCCTGGCTGCGGAGGCGG No data
Right 938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG No data
938463295_938463300 2 Left 938463295 2:131511470-131511492 CCTGGCCTGGCTGCGGAGGCGGG No data
Right 938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG No data
938463290_938463300 9 Left 938463290 2:131511463-131511485 CCACAGCCCTGGCCTGGCTGCGG No data
Right 938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG No data
938463287_938463300 29 Left 938463287 2:131511443-131511465 CCAAAGCGAGGACAGTATGGCCA No data
Right 938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938463300 Original CRISPR CTGCGCTGGCCCGCGGCTGC TGG Intergenic
No off target data available for this crispr