ID: 938463988

View in Genome Browser
Species Human (GRCh38)
Location 2:131515140-131515162
Sequence GCTTTCTGCACACACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938463977_938463988 27 Left 938463977 2:131515090-131515112 CCCAAAGTGCTGGAATTACAGGT 0: 3111
1: 86006
2: 313232
3: 241847
4: 148165
Right 938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG No data
938463984_938463988 -9 Left 938463984 2:131515126-131515148 CCTGGGTTCCATGTGCTTTCTGC No data
Right 938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG No data
938463978_938463988 26 Left 938463978 2:131515091-131515113 CCAAAGTGCTGGAATTACAGGTC 0: 16
1: 3808
2: 94655
3: 320956
4: 241482
Right 938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG No data
938463982_938463988 4 Left 938463982 2:131515113-131515135 CCGAGGCACCACACCTGGGTTCC No data
Right 938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG No data
938463975_938463988 30 Left 938463975 2:131515087-131515109 CCTCCCAAAGTGCTGGAATTACA 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954
Right 938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG No data
938463983_938463988 -4 Left 938463983 2:131515121-131515143 CCACACCTGGGTTCCATGTGCTT No data
Right 938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938463988 Original CRISPR GCTTTCTGCACACACTTGGG AGG Intergenic
No off target data available for this crispr