ID: 938464117

View in Genome Browser
Species Human (GRCh38)
Location 2:131515723-131515745
Sequence TTTGAACTCCTCCAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938464117_938464126 -4 Left 938464117 2:131515723-131515745 CCAGCCCCCTGGAGGAGTTCAAA No data
Right 938464126 2:131515742-131515764 CAAACGGTGGGTGGCCCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938464117 Original CRISPR TTTGAACTCCTCCAGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr