ID: 938464536

View in Genome Browser
Species Human (GRCh38)
Location 2:131517477-131517499
Sequence GAGGCCCCTTTCCAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938464536_938464538 -10 Left 938464536 2:131517477-131517499 CCATCCACTTGGAAAGGGGCCTC No data
Right 938464538 2:131517490-131517512 AAGGGGCCTCAGCCTTGCTAAGG No data
938464536_938464542 8 Left 938464536 2:131517477-131517499 CCATCCACTTGGAAAGGGGCCTC No data
Right 938464542 2:131517508-131517530 TAAGGATGTGGCGTCCTCAGAGG No data
938464536_938464540 -4 Left 938464536 2:131517477-131517499 CCATCCACTTGGAAAGGGGCCTC No data
Right 938464540 2:131517496-131517518 CCTCAGCCTTGCTAAGGATGTGG No data
938464536_938464545 15 Left 938464536 2:131517477-131517499 CCATCCACTTGGAAAGGGGCCTC No data
Right 938464545 2:131517515-131517537 GTGGCGTCCTCAGAGGGCCTGGG No data
938464536_938464543 9 Left 938464536 2:131517477-131517499 CCATCCACTTGGAAAGGGGCCTC No data
Right 938464543 2:131517509-131517531 AAGGATGTGGCGTCCTCAGAGGG No data
938464536_938464544 14 Left 938464536 2:131517477-131517499 CCATCCACTTGGAAAGGGGCCTC No data
Right 938464544 2:131517514-131517536 TGTGGCGTCCTCAGAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938464536 Original CRISPR GAGGCCCCTTTCCAAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr