ID: 938465515

View in Genome Browser
Species Human (GRCh38)
Location 2:131522324-131522346
Sequence AGGGACTTCTGGGGAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938465508_938465515 -3 Left 938465508 2:131522304-131522326 CCGGCCAGGAGGCACTTGTGAGG 0: 2
1: 0
2: 1
3: 21
4: 165
Right 938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG No data
938465511_938465515 -7 Left 938465511 2:131522308-131522330 CCAGGAGGCACTTGTGAGGGACT 0: 2
1: 0
2: 0
3: 14
4: 143
Right 938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG No data
938465507_938465515 -2 Left 938465507 2:131522303-131522325 CCCGGCCAGGAGGCACTTGTGAG 0: 2
1: 0
2: 1
3: 23
4: 236
Right 938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938465515 Original CRISPR AGGGACTTCTGGGGAAAGAC TGG Intergenic
No off target data available for this crispr