ID: 938465751

View in Genome Browser
Species Human (GRCh38)
Location 2:131523806-131523828
Sequence CATGCCCATCTGAGGTTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938465751_938465757 24 Left 938465751 2:131523806-131523828 CCCGAAAACCTCAGATGGGCATG No data
Right 938465757 2:131523853-131523875 ATGTGTTTAGGAACTCCCAAGGG 0: 2
1: 0
2: 0
3: 6
4: 115
938465751_938465758 29 Left 938465751 2:131523806-131523828 CCCGAAAACCTCAGATGGGCATG No data
Right 938465758 2:131523858-131523880 TTTAGGAACTCCCAAGGGTAAGG 0: 2
1: 0
2: 0
3: 7
4: 90
938465751_938465755 12 Left 938465751 2:131523806-131523828 CCCGAAAACCTCAGATGGGCATG No data
Right 938465755 2:131523841-131523863 TAAACACACTGCATGTGTTTAGG 0: 2
1: 0
2: 2
3: 26
4: 203
938465751_938465756 23 Left 938465751 2:131523806-131523828 CCCGAAAACCTCAGATGGGCATG No data
Right 938465756 2:131523852-131523874 CATGTGTTTAGGAACTCCCAAGG 0: 2
1: 0
2: 1
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938465751 Original CRISPR CATGCCCATCTGAGGTTTTC GGG (reversed) Intergenic
No off target data available for this crispr