ID: 938469231

View in Genome Browser
Species Human (GRCh38)
Location 2:131544220-131544242
Sequence CCCCCACCCCGCCACGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938469231_938469241 22 Left 938469231 2:131544220-131544242 CCCTACCCGTGGCGGGGTGGGGG No data
Right 938469241 2:131544265-131544287 TGTGCAGCAACACCTGTGGCTGG No data
938469231_938469242 23 Left 938469231 2:131544220-131544242 CCCTACCCGTGGCGGGGTGGGGG No data
Right 938469242 2:131544266-131544288 GTGCAGCAACACCTGTGGCTGGG No data
938469231_938469239 -9 Left 938469231 2:131544220-131544242 CCCTACCCGTGGCGGGGTGGGGG No data
Right 938469239 2:131544234-131544256 GGGTGGGGGCGGCGATTTTGGGG No data
938469231_938469240 18 Left 938469231 2:131544220-131544242 CCCTACCCGTGGCGGGGTGGGGG No data
Right 938469240 2:131544261-131544283 GTCTTGTGCAGCAACACCTGTGG No data
938469231_938469243 28 Left 938469231 2:131544220-131544242 CCCTACCCGTGGCGGGGTGGGGG No data
Right 938469243 2:131544271-131544293 GCAACACCTGTGGCTGGGTCAGG No data
938469231_938469238 -10 Left 938469231 2:131544220-131544242 CCCTACCCGTGGCGGGGTGGGGG No data
Right 938469238 2:131544233-131544255 GGGGTGGGGGCGGCGATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938469231 Original CRISPR CCCCCACCCCGCCACGGGTA GGG (reversed) Intergenic
No off target data available for this crispr