ID: 938469369

View in Genome Browser
Species Human (GRCh38)
Location 2:131544803-131544825
Sequence GGCTGCACTCCTTGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938469369_938469387 24 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469369_938469378 0 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469378 2:131544826-131544848 CTGGTGGGCCCAGCAATTTCTGG No data
938469369_938469384 20 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data
938469369_938469385 21 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469369_938469383 19 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469383 2:131544845-131544867 CTGGCCAGTTGCACCTGGATGGG No data
938469369_938469382 18 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469382 2:131544844-131544866 TCTGGCCAGTTGCACCTGGATGG No data
938469369_938469381 14 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469381 2:131544840-131544862 AATTTCTGGCCAGTTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938469369 Original CRISPR GGCTGCACTCCTTGGGGAGC AGG (reversed) Intergenic