ID: 938469378

View in Genome Browser
Species Human (GRCh38)
Location 2:131544826-131544848
Sequence CTGGTGGGCCCAGCAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938469369_938469378 0 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469378 2:131544826-131544848 CTGGTGGGCCCAGCAATTTCTGG No data
938469372_938469378 -7 Left 938469372 2:131544810-131544832 CCCAAGGAGTGCAGCCCTGGTGG No data
Right 938469378 2:131544826-131544848 CTGGTGGGCCCAGCAATTTCTGG No data
938469371_938469378 -6 Left 938469371 2:131544809-131544831 CCCCAAGGAGTGCAGCCCTGGTG No data
Right 938469378 2:131544826-131544848 CTGGTGGGCCCAGCAATTTCTGG No data
938469374_938469378 -8 Left 938469374 2:131544811-131544833 CCAAGGAGTGCAGCCCTGGTGGG No data
Right 938469378 2:131544826-131544848 CTGGTGGGCCCAGCAATTTCTGG No data
938469368_938469378 6 Left 938469368 2:131544797-131544819 CCTACTCCTGCTCCCCAAGGAGT No data
Right 938469378 2:131544826-131544848 CTGGTGGGCCCAGCAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938469378 Original CRISPR CTGGTGGGCCCAGCAATTTC TGG Intergenic
No off target data available for this crispr