ID: 938469384

View in Genome Browser
Species Human (GRCh38)
Location 2:131544846-131544868
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938469372_938469384 13 Left 938469372 2:131544810-131544832 CCCAAGGAGTGCAGCCCTGGTGG No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data
938469374_938469384 12 Left 938469374 2:131544811-131544833 CCAAGGAGTGCAGCCCTGGTGGG No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data
938469377_938469384 -2 Left 938469377 2:131544825-131544847 CCTGGTGGGCCCAGCAATTTCTG No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data
938469376_938469384 -1 Left 938469376 2:131544824-131544846 CCCTGGTGGGCCCAGCAATTTCT No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data
938469371_938469384 14 Left 938469371 2:131544809-131544831 CCCCAAGGAGTGCAGCCCTGGTG No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data
938469369_938469384 20 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data
938469368_938469384 26 Left 938469368 2:131544797-131544819 CCTACTCCTGCTCCCCAAGGAGT No data
Right 938469384 2:131544846-131544868 TGGCCAGTTGCACCTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr