ID: 938469385

View in Genome Browser
Species Human (GRCh38)
Location 2:131544847-131544869
Sequence GGCCAGTTGCACCTGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938469368_938469385 27 Left 938469368 2:131544797-131544819 CCTACTCCTGCTCCCCAAGGAGT No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469372_938469385 14 Left 938469372 2:131544810-131544832 CCCAAGGAGTGCAGCCCTGGTGG No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469379_938469385 -10 Left 938469379 2:131544834-131544856 CCCAGCAATTTCTGGCCAGTTGC No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469371_938469385 15 Left 938469371 2:131544809-131544831 CCCCAAGGAGTGCAGCCCTGGTG No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469377_938469385 -1 Left 938469377 2:131544825-131544847 CCTGGTGGGCCCAGCAATTTCTG No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469369_938469385 21 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469376_938469385 0 Left 938469376 2:131544824-131544846 CCCTGGTGGGCCCAGCAATTTCT No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data
938469374_938469385 13 Left 938469374 2:131544811-131544833 CCAAGGAGTGCAGCCCTGGTGGG No data
Right 938469385 2:131544847-131544869 GGCCAGTTGCACCTGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938469385 Original CRISPR GGCCAGTTGCACCTGGATGG GGG Intergenic
No off target data available for this crispr