ID: 938469387

View in Genome Browser
Species Human (GRCh38)
Location 2:131544850-131544872
Sequence CAGTTGCACCTGGATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938469379_938469387 -7 Left 938469379 2:131544834-131544856 CCCAGCAATTTCTGGCCAGTTGC No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469376_938469387 3 Left 938469376 2:131544824-131544846 CCCTGGTGGGCCCAGCAATTTCT No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469369_938469387 24 Left 938469369 2:131544803-131544825 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469374_938469387 16 Left 938469374 2:131544811-131544833 CCAAGGAGTGCAGCCCTGGTGGG No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469371_938469387 18 Left 938469371 2:131544809-131544831 CCCCAAGGAGTGCAGCCCTGGTG No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469372_938469387 17 Left 938469372 2:131544810-131544832 CCCAAGGAGTGCAGCCCTGGTGG No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469377_938469387 2 Left 938469377 2:131544825-131544847 CCTGGTGGGCCCAGCAATTTCTG No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469368_938469387 30 Left 938469368 2:131544797-131544819 CCTACTCCTGCTCCCCAAGGAGT No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data
938469380_938469387 -8 Left 938469380 2:131544835-131544857 CCAGCAATTTCTGGCCAGTTGCA No data
Right 938469387 2:131544850-131544872 CAGTTGCACCTGGATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938469387 Original CRISPR CAGTTGCACCTGGATGGGGG TGG Intergenic
No off target data available for this crispr