ID: 938473146

View in Genome Browser
Species Human (GRCh38)
Location 2:131584604-131584626
Sequence TAGAAAATGCAGAAGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938473146_938473148 -1 Left 938473146 2:131584604-131584626 CCAGGCTACTTCTGCATTTTCTA No data
Right 938473148 2:131584626-131584648 AACTTGTCTAGGTGAAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938473146 Original CRISPR TAGAAAATGCAGAAGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr