ID: 938481271

View in Genome Browser
Species Human (GRCh38)
Location 2:131663656-131663678
Sequence TCCAGGACGTTGAGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938481271_938481274 3 Left 938481271 2:131663656-131663678 CCTCAGCCTCTCAACGTCCTGGA No data
Right 938481274 2:131663682-131663704 ACAGCATGAGCTGCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938481271 Original CRISPR TCCAGGACGTTGAGAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr