ID: 938481274

View in Genome Browser
Species Human (GRCh38)
Location 2:131663682-131663704
Sequence ACAGCATGAGCTGCCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938481272_938481274 -3 Left 938481272 2:131663662-131663684 CCTCTCAACGTCCTGGAATGACA No data
Right 938481274 2:131663682-131663704 ACAGCATGAGCTGCCACACCTGG No data
938481269_938481274 7 Left 938481269 2:131663652-131663674 CCTGCCTCAGCCTCTCAACGTCC No data
Right 938481274 2:131663682-131663704 ACAGCATGAGCTGCCACACCTGG No data
938481271_938481274 3 Left 938481271 2:131663656-131663678 CCTCAGCCTCTCAACGTCCTGGA No data
Right 938481274 2:131663682-131663704 ACAGCATGAGCTGCCACACCTGG No data
938481268_938481274 10 Left 938481268 2:131663649-131663671 CCACCTGCCTCAGCCTCTCAACG 0: 3
1: 1365
2: 30728
3: 92410
4: 175988
Right 938481274 2:131663682-131663704 ACAGCATGAGCTGCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938481274 Original CRISPR ACAGCATGAGCTGCCACACC TGG Intergenic
No off target data available for this crispr