ID: 938481834

View in Genome Browser
Species Human (GRCh38)
Location 2:131669487-131669509
Sequence AGCCCTCCTCAGAGACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938481834_938481841 4 Left 938481834 2:131669487-131669509 CCCCCGGGTCTCTGAGGAGGGCT No data
Right 938481841 2:131669514-131669536 CCTCCATCACAGAGAATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938481834 Original CRISPR AGCCCTCCTCAGAGACCCGG GGG (reversed) Intergenic
No off target data available for this crispr