ID: 938484429

View in Genome Browser
Species Human (GRCh38)
Location 2:131689634-131689656
Sequence CATGTCCGTCCGCACATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938484429_938484436 0 Left 938484429 2:131689634-131689656 CCAACCATGTGCGGACGGACATG No data
Right 938484436 2:131689657-131689679 GGGTGGGTCATTTCAAAGTGAGG No data
938484429_938484439 24 Left 938484429 2:131689634-131689656 CCAACCATGTGCGGACGGACATG No data
Right 938484439 2:131689681-131689703 AGTCAACCTGGGCCCTAGACTGG No data
938484429_938484438 13 Left 938484429 2:131689634-131689656 CCAACCATGTGCGGACGGACATG No data
Right 938484438 2:131689670-131689692 CAAAGTGAGGTAGTCAACCTGGG No data
938484429_938484437 12 Left 938484429 2:131689634-131689656 CCAACCATGTGCGGACGGACATG No data
Right 938484437 2:131689669-131689691 TCAAAGTGAGGTAGTCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938484429 Original CRISPR CATGTCCGTCCGCACATGGT TGG (reversed) Intergenic
No off target data available for this crispr