ID: 938484433

View in Genome Browser
Species Human (GRCh38)
Location 2:131689638-131689660
Sequence ACCCCATGTCCGTCCGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938484433_938484439 20 Left 938484433 2:131689638-131689660 CCATGTGCGGACGGACATGGGGT No data
Right 938484439 2:131689681-131689703 AGTCAACCTGGGCCCTAGACTGG No data
938484433_938484438 9 Left 938484433 2:131689638-131689660 CCATGTGCGGACGGACATGGGGT No data
Right 938484438 2:131689670-131689692 CAAAGTGAGGTAGTCAACCTGGG No data
938484433_938484437 8 Left 938484433 2:131689638-131689660 CCATGTGCGGACGGACATGGGGT No data
Right 938484437 2:131689669-131689691 TCAAAGTGAGGTAGTCAACCTGG No data
938484433_938484436 -4 Left 938484433 2:131689638-131689660 CCATGTGCGGACGGACATGGGGT No data
Right 938484436 2:131689657-131689679 GGGTGGGTCATTTCAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938484433 Original CRISPR ACCCCATGTCCGTCCGCACA TGG (reversed) Intergenic
No off target data available for this crispr