ID: 938484436

View in Genome Browser
Species Human (GRCh38)
Location 2:131689657-131689679
Sequence GGGTGGGTCATTTCAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938484433_938484436 -4 Left 938484433 2:131689638-131689660 CCATGTGCGGACGGACATGGGGT No data
Right 938484436 2:131689657-131689679 GGGTGGGTCATTTCAAAGTGAGG No data
938484429_938484436 0 Left 938484429 2:131689634-131689656 CCAACCATGTGCGGACGGACATG No data
Right 938484436 2:131689657-131689679 GGGTGGGTCATTTCAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938484436 Original CRISPR GGGTGGGTCATTTCAAAGTG AGG Intergenic
No off target data available for this crispr