ID: 938485778

View in Genome Browser
Species Human (GRCh38)
Location 2:131706350-131706372
Sequence ATGTGGTGATGAGCTCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938485778_938485784 1 Left 938485778 2:131706350-131706372 CCCAAAAGAGCTCATCACCACAT No data
Right 938485784 2:131706374-131706396 TGCATGTTAGCTAGGGAAAAGGG No data
938485778_938485780 -7 Left 938485778 2:131706350-131706372 CCCAAAAGAGCTCATCACCACAT No data
Right 938485780 2:131706366-131706388 ACCACATCTGCATGTTAGCTAGG No data
938485778_938485785 2 Left 938485778 2:131706350-131706372 CCCAAAAGAGCTCATCACCACAT No data
Right 938485785 2:131706375-131706397 GCATGTTAGCTAGGGAAAAGGGG No data
938485778_938485783 0 Left 938485778 2:131706350-131706372 CCCAAAAGAGCTCATCACCACAT No data
Right 938485783 2:131706373-131706395 CTGCATGTTAGCTAGGGAAAAGG No data
938485778_938485782 -6 Left 938485778 2:131706350-131706372 CCCAAAAGAGCTCATCACCACAT No data
Right 938485782 2:131706367-131706389 CCACATCTGCATGTTAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938485778 Original CRISPR ATGTGGTGATGAGCTCTTTT GGG (reversed) Intergenic
No off target data available for this crispr