ID: 938485965

View in Genome Browser
Species Human (GRCh38)
Location 2:131708824-131708846
Sequence GCAATCGTGCATCTTCTCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938485965_938485972 11 Left 938485965 2:131708824-131708846 CCGATGAGAAGATGCACGATTGC No data
Right 938485972 2:131708858-131708880 TGAGGGCTGCAACAGAGGAAGGG No data
938485965_938485970 6 Left 938485965 2:131708824-131708846 CCGATGAGAAGATGCACGATTGC No data
Right 938485970 2:131708853-131708875 GGTACTGAGGGCTGCAACAGAGG No data
938485965_938485967 -7 Left 938485965 2:131708824-131708846 CCGATGAGAAGATGCACGATTGC No data
Right 938485967 2:131708840-131708862 CGATTGCCATTCAGGTACTGAGG No data
938485965_938485971 10 Left 938485965 2:131708824-131708846 CCGATGAGAAGATGCACGATTGC No data
Right 938485971 2:131708857-131708879 CTGAGGGCTGCAACAGAGGAAGG No data
938485965_938485968 -6 Left 938485965 2:131708824-131708846 CCGATGAGAAGATGCACGATTGC No data
Right 938485968 2:131708841-131708863 GATTGCCATTCAGGTACTGAGGG No data
938485965_938485973 14 Left 938485965 2:131708824-131708846 CCGATGAGAAGATGCACGATTGC No data
Right 938485973 2:131708861-131708883 GGGCTGCAACAGAGGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938485965 Original CRISPR GCAATCGTGCATCTTCTCAT CGG (reversed) Intergenic
No off target data available for this crispr