ID: 938488123

View in Genome Browser
Species Human (GRCh38)
Location 2:131735879-131735901
Sequence CACCCCACTCACCCAAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938488123_938488125 -10 Left 938488123 2:131735879-131735901 CCCTGGTTTGGGTGAGTGGGGTG No data
Right 938488125 2:131735892-131735914 GAGTGGGGTGTAAGAAGTAGAGG No data
938488123_938488126 -6 Left 938488123 2:131735879-131735901 CCCTGGTTTGGGTGAGTGGGGTG No data
Right 938488126 2:131735896-131735918 GGGGTGTAAGAAGTAGAGGCTGG No data
938488123_938488127 16 Left 938488123 2:131735879-131735901 CCCTGGTTTGGGTGAGTGGGGTG No data
Right 938488127 2:131735918-131735940 GAAAGATCTTGTTAAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938488123 Original CRISPR CACCCCACTCACCCAAACCA GGG (reversed) Intronic
No off target data available for this crispr