ID: 938489287

View in Genome Browser
Species Human (GRCh38)
Location 2:131753606-131753628
Sequence CCAGGGACGCCAGGTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938489287_938489294 1 Left 938489287 2:131753606-131753628 CCAGTGGAACCTGGCGTCCCTGG No data
Right 938489294 2:131753630-131753652 TCCACCCCAGGGTGCGCCTCAGG No data
938489287_938489304 24 Left 938489287 2:131753606-131753628 CCAGTGGAACCTGGCGTCCCTGG No data
Right 938489304 2:131753653-131753675 CCGCTAGGGATACCTCAAGGCGG No data
938489287_938489300 10 Left 938489287 2:131753606-131753628 CCAGTGGAACCTGGCGTCCCTGG No data
Right 938489300 2:131753639-131753661 GGGTGCGCCTCAGGCCGCTAGGG No data
938489287_938489291 -10 Left 938489287 2:131753606-131753628 CCAGTGGAACCTGGCGTCCCTGG No data
Right 938489291 2:131753619-131753641 GCGTCCCTGGTTCCACCCCAGGG No data
938489287_938489299 9 Left 938489287 2:131753606-131753628 CCAGTGGAACCTGGCGTCCCTGG No data
Right 938489299 2:131753638-131753660 AGGGTGCGCCTCAGGCCGCTAGG No data
938489287_938489302 21 Left 938489287 2:131753606-131753628 CCAGTGGAACCTGGCGTCCCTGG No data
Right 938489302 2:131753650-131753672 AGGCCGCTAGGGATACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938489287 Original CRISPR CCAGGGACGCCAGGTTCCAC TGG (reversed) Intronic
No off target data available for this crispr