ID: 938496933

View in Genome Browser
Species Human (GRCh38)
Location 2:131802635-131802657
Sequence CTCCGCGCCTGCGCCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938496921_938496933 30 Left 938496921 2:131802582-131802604 CCCCAGGGCTGTTAGGACGGCGT No data
Right 938496933 2:131802635-131802657 CTCCGCGCCTGCGCCGGCGCTGG No data
938496923_938496933 28 Left 938496923 2:131802584-131802606 CCAGGGCTGTTAGGACGGCGTTA No data
Right 938496933 2:131802635-131802657 CTCCGCGCCTGCGCCGGCGCTGG No data
938496922_938496933 29 Left 938496922 2:131802583-131802605 CCCAGGGCTGTTAGGACGGCGTT No data
Right 938496933 2:131802635-131802657 CTCCGCGCCTGCGCCGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938496933 Original CRISPR CTCCGCGCCTGCGCCGGCGC TGG Intergenic