ID: 938501230

View in Genome Browser
Species Human (GRCh38)
Location 2:131832129-131832151
Sequence CATGCAGCCCCCACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938501230_938501241 19 Left 938501230 2:131832129-131832151 CCACACCCAGTGGGGGCTGCATG No data
Right 938501241 2:131832171-131832193 GCTGCGCTGGCTCCAATTTGGGG No data
938501230_938501238 6 Left 938501230 2:131832129-131832151 CCACACCCAGTGGGGGCTGCATG No data
Right 938501238 2:131832158-131832180 CTGGGGATCGTGAGCTGCGCTGG No data
938501230_938501239 17 Left 938501230 2:131832129-131832151 CCACACCCAGTGGGGGCTGCATG No data
Right 938501239 2:131832169-131832191 GAGCTGCGCTGGCTCCAATTTGG No data
938501230_938501240 18 Left 938501230 2:131832129-131832151 CCACACCCAGTGGGGGCTGCATG No data
Right 938501240 2:131832170-131832192 AGCTGCGCTGGCTCCAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938501230 Original CRISPR CATGCAGCCCCCACTGGGTG TGG (reversed) Intergenic