ID: 938501240

View in Genome Browser
Species Human (GRCh38)
Location 2:131832170-131832192
Sequence AGCTGCGCTGGCTCCAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938501230_938501240 18 Left 938501230 2:131832129-131832151 CCACACCCAGTGGGGGCTGCATG No data
Right 938501240 2:131832170-131832192 AGCTGCGCTGGCTCCAATTTGGG No data
938501234_938501240 12 Left 938501234 2:131832135-131832157 CCAGTGGGGGCTGCATGGTGGAG No data
Right 938501240 2:131832170-131832192 AGCTGCGCTGGCTCCAATTTGGG No data
938501233_938501240 13 Left 938501233 2:131832134-131832156 CCCAGTGGGGGCTGCATGGTGGA No data
Right 938501240 2:131832170-131832192 AGCTGCGCTGGCTCCAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938501240 Original CRISPR AGCTGCGCTGGCTCCAATTT GGG Intergenic
No off target data available for this crispr