ID: 938501241

View in Genome Browser
Species Human (GRCh38)
Location 2:131832171-131832193
Sequence GCTGCGCTGGCTCCAATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938501234_938501241 13 Left 938501234 2:131832135-131832157 CCAGTGGGGGCTGCATGGTGGAG No data
Right 938501241 2:131832171-131832193 GCTGCGCTGGCTCCAATTTGGGG No data
938501233_938501241 14 Left 938501233 2:131832134-131832156 CCCAGTGGGGGCTGCATGGTGGA No data
Right 938501241 2:131832171-131832193 GCTGCGCTGGCTCCAATTTGGGG No data
938501230_938501241 19 Left 938501230 2:131832129-131832151 CCACACCCAGTGGGGGCTGCATG No data
Right 938501241 2:131832171-131832193 GCTGCGCTGGCTCCAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938501241 Original CRISPR GCTGCGCTGGCTCCAATTTG GGG Intergenic
No off target data available for this crispr