ID: 938503914

View in Genome Browser
Species Human (GRCh38)
Location 2:131854694-131854716
Sequence ATGTTGTAGCTTACTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938503911_938503914 22 Left 938503911 2:131854649-131854671 CCTTTGAGACATTGATTTAAGCG No data
Right 938503914 2:131854694-131854716 ATGTTGTAGCTTACTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938503914 Original CRISPR ATGTTGTAGCTTACTGAACA AGG Intergenic
No off target data available for this crispr