ID: 938505782

View in Genome Browser
Species Human (GRCh38)
Location 2:131881169-131881191
Sequence AGTTGGTCCTATGGGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938505782_938505788 25 Left 938505782 2:131881169-131881191 CCTGATTCCCCATAGGACCAACT No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data
938505782_938505792 29 Left 938505782 2:131881169-131881191 CCTGATTCCCCATAGGACCAACT No data
Right 938505792 2:131881221-131881243 CCATCCAGTCAGACTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938505782 Original CRISPR AGTTGGTCCTATGGGGAATC AGG (reversed) Intergenic
No off target data available for this crispr