ID: 938505783

View in Genome Browser
Species Human (GRCh38)
Location 2:131881176-131881198
Sequence ACTTTATAGTTGGTCCTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938505783_938505788 18 Left 938505783 2:131881176-131881198 CCCCATAGGACCAACTATAAAGT No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data
938505783_938505792 22 Left 938505783 2:131881176-131881198 CCCCATAGGACCAACTATAAAGT No data
Right 938505792 2:131881221-131881243 CCATCCAGTCAGACTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938505783 Original CRISPR ACTTTATAGTTGGTCCTATG GGG (reversed) Intergenic
No off target data available for this crispr