ID: 938505786

View in Genome Browser
Species Human (GRCh38)
Location 2:131881186-131881208
Sequence AGTAAATTGTACTTTATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938505786_938505792 12 Left 938505786 2:131881186-131881208 CCAACTATAAAGTACAATTTACT No data
Right 938505792 2:131881221-131881243 CCATCCAGTCAGACTGAGGCTGG No data
938505786_938505788 8 Left 938505786 2:131881186-131881208 CCAACTATAAAGTACAATTTACT No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938505786 Original CRISPR AGTAAATTGTACTTTATAGT TGG (reversed) Intergenic