ID: 938505788

View in Genome Browser
Species Human (GRCh38)
Location 2:131881217-131881239
Sequence CTCCCCATCCAGTCAGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938505782_938505788 25 Left 938505782 2:131881169-131881191 CCTGATTCCCCATAGGACCAACT No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data
938505784_938505788 17 Left 938505784 2:131881177-131881199 CCCATAGGACCAACTATAAAGTA No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data
938505785_938505788 16 Left 938505785 2:131881178-131881200 CCATAGGACCAACTATAAAGTAC No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data
938505783_938505788 18 Left 938505783 2:131881176-131881198 CCCCATAGGACCAACTATAAAGT No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data
938505786_938505788 8 Left 938505786 2:131881186-131881208 CCAACTATAAAGTACAATTTACT No data
Right 938505788 2:131881217-131881239 CTCCCCATCCAGTCAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938505788 Original CRISPR CTCCCCATCCAGTCAGACTG AGG Intergenic
No off target data available for this crispr