ID: 938514998

View in Genome Browser
Species Human (GRCh38)
Location 2:131995062-131995084
Sequence GTTTCTATGCAGAAATTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938514998_938514999 19 Left 938514998 2:131995062-131995084 CCATGCAATTTCTGCATAGAAAC No data
Right 938514999 2:131995104-131995126 CAACCAATCAACCAGTAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938514998 Original CRISPR GTTTCTATGCAGAAATTGCA TGG (reversed) Intergenic
No off target data available for this crispr