ID: 938521245

View in Genome Browser
Species Human (GRCh38)
Location 2:132072583-132072605
Sequence CAGAACCTGTAGCAGTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938521245_938521246 -2 Left 938521245 2:132072583-132072605 CCAGATCACTGCTACAGGTTCTG No data
Right 938521246 2:132072604-132072626 TGAATGTTTGTCCCTCACAAAGG No data
938521245_938521249 19 Left 938521245 2:132072583-132072605 CCAGATCACTGCTACAGGTTCTG No data
Right 938521249 2:132072625-132072647 GGATTCTAGAACACTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938521245 Original CRISPR CAGAACCTGTAGCAGTGATC TGG (reversed) Intergenic
No off target data available for this crispr