ID: 938528835

View in Genome Browser
Species Human (GRCh38)
Location 2:132162748-132162770
Sequence GGCGCGAGCCAAGGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938528835_938528838 -4 Left 938528835 2:132162748-132162770 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 938528838 2:132162767-132162789 CGCCCTGAGCGCTGGTTTGCAGG No data
938528835_938528844 27 Left 938528835 2:132162748-132162770 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 938528844 2:132162798-132162820 ACTGTGCAGTCGCCAGGATGCGG No data
938528835_938528841 2 Left 938528835 2:132162748-132162770 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 938528841 2:132162773-132162795 GAGCGCTGGTTTGCAGGCTCTGG No data
938528835_938528843 21 Left 938528835 2:132162748-132162770 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 938528843 2:132162792-132162814 CTGGGCACTGTGCAGTCGCCAGG No data
938528835_938528842 3 Left 938528835 2:132162748-132162770 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 938528842 2:132162774-132162796 AGCGCTGGTTTGCAGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938528835 Original CRISPR GGCGCGAGCCAAGGAAGAGC AGG (reversed) Intronic
No off target data available for this crispr