ID: 938531841

View in Genome Browser
Species Human (GRCh38)
Location 2:132195560-132195582
Sequence ATGGGTAAATCATCTGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938531830_938531841 26 Left 938531830 2:132195511-132195533 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 938531841 2:132195560-132195582 ATGGGTAAATCATCTGAGGTCGG No data
938531836_938531841 -2 Left 938531836 2:132195539-132195561 CCAGCACCTTGGGAGGCTGAGAT 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
Right 938531841 2:132195560-132195582 ATGGGTAAATCATCTGAGGTCGG No data
938531833_938531841 7 Left 938531833 2:132195530-132195552 CCTGTAATCCCAGCACCTTGGGA 0: 2812
1: 291411
2: 316717
3: 298341
4: 307267
Right 938531841 2:132195560-132195582 ATGGGTAAATCATCTGAGGTCGG No data
938531835_938531841 -1 Left 938531835 2:132195538-132195560 CCCAGCACCTTGGGAGGCTGAGA 0: 79
1: 7041
2: 117363
3: 345517
4: 455733
Right 938531841 2:132195560-132195582 ATGGGTAAATCATCTGAGGTCGG No data
938531839_938531841 -8 Left 938531839 2:132195545-132195567 CCTTGGGAGGCTGAGATGGGTAA No data
Right 938531841 2:132195560-132195582 ATGGGTAAATCATCTGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938531841 Original CRISPR ATGGGTAAATCATCTGAGGT CGG Intronic
No off target data available for this crispr