ID: 938536883

View in Genome Browser
Species Human (GRCh38)
Location 2:132255028-132255050
Sequence TTTGGGTTCCGAGGGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536883_938536896 21 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536883_938536895 20 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536895 2:132255071-132255093 GGAAGCTGCCCAGCGGGTCATGG No data
938536883_938536893 13 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data
938536883_938536894 14 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536883_938536887 -9 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536887 2:132255042-132255064 GAACCCAAAAACCCAAAGACTGG No data
938536883_938536890 -1 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536890 2:132255050-132255072 AAACCCAAAGACTGGTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536883 Original CRISPR TTTGGGTTCCGAGGGGAGTA TGG (reversed) Intronic