ID: 938536886

View in Genome Browser
Species Human (GRCh38)
Location 2:132255037-132255059
Sequence CTTTGGGTTTTTGGGTTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536886_938536894 5 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536886_938536896 12 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536886_938536890 -10 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536890 2:132255050-132255072 AAACCCAAAGACTGGTTTCTTGG No data
938536886_938536895 11 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536895 2:132255071-132255093 GGAAGCTGCCCAGCGGGTCATGG No data
938536886_938536893 4 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536886 Original CRISPR CTTTGGGTTTTTGGGTTCCG AGG (reversed) Intronic