ID: 938536888

View in Genome Browser
Species Human (GRCh38)
Location 2:132255045-132255067
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536888_938536893 -4 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data
938536888_938536899 30 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536899 2:132255098-132255120 AACACCGCCACATCGCCAGTTGG No data
938536888_938536894 -3 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536888_938536895 3 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536895 2:132255071-132255093 GGAAGCTGCCCAGCGGGTCATGG No data
938536888_938536896 4 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536888 Original CRISPR AAACCAGTCTTTGGGTTTTT GGG (reversed) Intronic