ID: 938536890

View in Genome Browser
Species Human (GRCh38)
Location 2:132255050-132255072
Sequence AAACCCAAAGACTGGTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536884_938536890 -8 Left 938536884 2:132255035-132255057 CCCCTCGGAACCCAAAAACCCAA No data
Right 938536890 2:132255050-132255072 AAACCCAAAGACTGGTTTCTTGG No data
938536881_938536890 21 Left 938536881 2:132255006-132255028 CCTTTAAGTTTCAGCTTTGCAAC No data
Right 938536890 2:132255050-132255072 AAACCCAAAGACTGGTTTCTTGG No data
938536883_938536890 -1 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536890 2:132255050-132255072 AAACCCAAAGACTGGTTTCTTGG No data
938536886_938536890 -10 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536890 2:132255050-132255072 AAACCCAAAGACTGGTTTCTTGG No data
938536885_938536890 -9 Left 938536885 2:132255036-132255058 CCCTCGGAACCCAAAAACCCAAA No data
Right 938536890 2:132255050-132255072 AAACCCAAAGACTGGTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536890 Original CRISPR AAACCCAAAGACTGGTTTCT TGG Intronic