ID: 938536891

View in Genome Browser
Species Human (GRCh38)
Location 2:132255053-132255075
Sequence CTTCCAAGAAACCAGTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536891_938536895 -5 Left 938536891 2:132255053-132255075 CCCAAAGACTGGTTTCTTGGAAG No data
Right 938536895 2:132255071-132255093 GGAAGCTGCCCAGCGGGTCATGG No data
938536891_938536896 -4 Left 938536891 2:132255053-132255075 CCCAAAGACTGGTTTCTTGGAAG No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536891_938536899 22 Left 938536891 2:132255053-132255075 CCCAAAGACTGGTTTCTTGGAAG No data
Right 938536899 2:132255098-132255120 AACACCGCCACATCGCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536891 Original CRISPR CTTCCAAGAAACCAGTCTTT GGG (reversed) Intronic