ID: 938536892 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:132255054-132255076 |
| Sequence | GCTTCCAAGAAACCAGTCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938536892_938536899 | 21 | Left | 938536892 | 2:132255054-132255076 | CCAAAGACTGGTTTCTTGGAAGC | No data | ||
| Right | 938536899 | 2:132255098-132255120 | AACACCGCCACATCGCCAGTTGG | No data | ||||
| 938536892_938536896 | -5 | Left | 938536892 | 2:132255054-132255076 | CCAAAGACTGGTTTCTTGGAAGC | No data | ||
| Right | 938536896 | 2:132255072-132255094 | GAAGCTGCCCAGCGGGTCATGGG | No data | ||||
| 938536892_938536895 | -6 | Left | 938536892 | 2:132255054-132255076 | CCAAAGACTGGTTTCTTGGAAGC | No data | ||
| Right | 938536895 | 2:132255071-132255093 | GGAAGCTGCCCAGCGGGTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938536892 | Original CRISPR | GCTTCCAAGAAACCAGTCTT TGG (reversed) | Intronic | ||