ID: 938536893

View in Genome Browser
Species Human (GRCh38)
Location 2:132255064-132255086
Sequence GTTTCTTGGAAGCTGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536883_938536893 13 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data
938536884_938536893 6 Left 938536884 2:132255035-132255057 CCCCTCGGAACCCAAAAACCCAA No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data
938536886_938536893 4 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data
938536885_938536893 5 Left 938536885 2:132255036-132255058 CCCTCGGAACCCAAAAACCCAAA No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data
938536888_938536893 -4 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data
938536889_938536893 -5 Left 938536889 2:132255046-132255068 CCAAAAACCCAAAGACTGGTTTC No data
Right 938536893 2:132255064-132255086 GTTTCTTGGAAGCTGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536893 Original CRISPR GTTTCTTGGAAGCTGCCCAG CGG Intronic